Instructions to use multimolecule/dnaberts with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- MultiMolecule
How to use multimolecule/dnaberts with MultiMolecule:
pip install multimolecule
from multimolecule import AutoModel, AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnaberts") model = AutoModel.from_pretrained("multimolecule/dnaberts") inputs = tokenizer("ACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGG", return_tensors="pt") outputs = model(**inputs) embeddings = outputs.last_hidden_state - Notebooks
- Google Colab
- Kaggle
File size: 13,609 Bytes
ffb2998 | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 | ---
datasets:
- multimolecule/genbank
library_name: multimolecule
license: agpl-3.0
mask_token: <mask>
pipeline_tag: feature-extraction
tags:
- Biology
- DNA
- dna
widget:
- example_title: tumor protein p53
pipeline_tag: feature-extraction
sequence_type: DNA
task: feature-extraction
text: ACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGG
- example_title: BRCA1 DNA repair associated
pipeline_tag: feature-extraction
sequence_type: DNA
task: feature-extraction
text: TCATTGGAACAGAAAGAAATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGTGTCCCATCTGG
- example_title: hemoglobin subunit beta
pipeline_tag: feature-extraction
sequence_type: DNA
task: feature-extraction
text: CATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGG
- example_title: CF transmembrane conductance regulator
pipeline_tag: feature-extraction
sequence_type: DNA
task: feature-extraction
text: ACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAG
- example_title: telomerase reverse transcriptase
pipeline_tag: feature-extraction
sequence_type: DNA
task: feature-extraction
text: CGCGGGGGTGGCCGGGGCCAGGGCTTCCCACGTGCGCAGCAGGACGCAGCGCTGCCTGAAACTCGCGCCGCGAGGAGAGGGCGGGGCCGCGGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGACCCGGGAGGGGTCGGGACGGGGCGGGGTCCGCGCGGAGGAGGCGGAGCTGGAAGGTGAAGGGGCAGGACGGGTGCCCGGGTCCCCAGTCCCTCCGCCACGTGGGAAGCGCGGTCCTGGGCGTCTGTGCCCGCGAATCCACTGGGAGCCCGGCCTGGCCCCGACAGCGCAGCTGCTCCGGGCGGACCCGGGG
- example_title: KRAS proto-oncogene
pipeline_tag: feature-extraction
sequence_type: DNA
task: feature-extraction
text: GCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAG
- example_title: prion protein (Kanno blood group)
pipeline_tag: feature-extraction
sequence_type: cDNA
task: feature-extraction
text: ATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGC
- example_title: interleukin 10
pipeline_tag: feature-extraction
sequence_type: cDNA
task: feature-extraction
text: ATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCC
- example_title: Zaire ebolavirus
pipeline_tag: feature-extraction
sequence_type: cDNA
task: feature-extraction
text: AATGTTCAAACACTTTGTGAAGCTCTGTTAGCTGATGGTCTTGCTAAAGCATTTCCTAGCAATATGATGGTAGTCACAGAGCGTGAGCAAAAAGAAAGCTTATTGCATCAAGCATCATGGCACCACACAAGTGATGATTTTGGTGAGCATGCCACAGTTAGAGGGAGTAGCTTTGTAACTGATTTAGAGAAATACAATCTTGCATTTAGATATGAGTTTACAGCACCTTTTATAGAATATTGTAACCGTTGCTATGGTGTTAAGAATGTTTTTAATTGGATGCATTATACAATCCCACAGTGTTAT
- example_title: SARS coronavirus
pipeline_tag: feature-extraction
sequence_type: cDNA
task: feature-extraction
text: ATGTTTATTTTCTTATTATTTCTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATGATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTTTACTATCCTGATGAAATTTTTAGATCAGACACTCTTTATTTAACTCAGGATTTATTTCTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGACAACCCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCAAATGTTGTCCGTGGTTGGGTTTTTGGTTCTACCATGAACAACAAGTCACAGTCGGTGATTATTATTAACAATTCTACTAATGTTGTTATACGAGCATGTAACTTTGAATTGTGTGACAACCCTTTCTTTGCTGTTTCTAAACCCATGGGTACACAGACACATACTATGATATTCGATAATGCATTTAAATGCACTTTCGAGTACATATCT
- example_title: insulin
pipeline_tag: feature-extraction
sequence_type: cDNA
task: feature-extraction
text: ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG
- example_title: cyclin dependent kinase inhibitor 2A
pipeline_tag: feature-extraction
sequence_type: cDNA
task: feature-extraction
text: ATGGAGCCGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGGTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCCGATCCAGGTCATGATGATGGGCAGCGCCCGAGTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAGCCCAACTGCGCCGACCCCGCCACTCTCACCCGACCCGTGCACGACGCTGCCCGGGAGGGCTTCCTGGACACGCTGGTGGTGCTGCACCGGGCCGGGGCGCGGCTGGACGTGCGCGATGCCTGGGGCCGTCTGCCCGTGGACCTGGCTGAGGAGCTGGGCCATCGCGATGTCGCACGGTACCTGCGCGCGGCTGCGGGGGGCACCAGAGGCAGTAACCATGCCCGCATAGATGCCGCGGAAGGTCCCTCAGACATCCCCGATTGA
- example_title: human papillomavirus type 16 E6
pipeline_tag: feature-extraction
sequence_type: cDNA
task: feature-extraction
text: ATGCACCAAAAGAGAACTGCAATGTTTCAGGACCCACAGGAGCGACCCAGAAAGTTACCACAGTTATGCACAGAGCTGCAAACAACTATACATGATATAATATTAGAATGTGTGTACTGCAAGCAACAGTTACTGCGACGTGAGGTATATGACTTTGCTTTTCGGGATTTATGCATAGTATATAGAGATGGGAATCCATATGCTGTATGTGATAAATGTTTAAAGTTTTATTCTAAAATTAGTGAGTATAGACATTATTGTTATAGTTTGTATGGAACAACATTAGAACAGCAATACAACAAACCGTTGTGTGATTTGTTAATTAGGTGTATTAACTGTCAAAAGCCACTGTGTCCTGAAGAAAAGCAAAGACATCTGGACAAAAAGCAAAGATTCCATAATATAAGGGGTCGGTGGACCGGTCGATGTATGTCTTGTTGCAGATCATCAAGAACACGTAGAGAAACCCAGCTGTAA
---
# DNABERT-S
Pre-trained model on multi-species genome using a contrastive learning objective for species-aware DNA embeddings.
## Disclaimer
This is an UNOFFICIAL implementation of the [DNABERT-S: pioneering species differentiation with species-aware DNA embeddings](https://doi.org/10.1093/bioinformatics/btaf188) by Zhihan Zhou, et al.
The OFFICIAL repository of DNABERT-S is at [MAGICS-LAB/DNABERT_S](https://github.com/MAGICS-LAB/DNABERT_S).
> [!TIP]
> The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
**The team releasing DNABERT-S did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
DNABERT-S is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model built upon [DNABERT-2](https://huggingface.co/multimolecule/dnabert2) and fine-tuned with contrastive learning for species-aware DNA embeddings. The model was trained using the proposed Curriculum Contrastive Learning (C²LR) strategy with the Manifold Instance Mixup (MI-Mix) training objective.
DNABERT-S shares the same architecture as DNABERT-2: it uses Byte Pair Encoding (BPE) tokenization, Attention with Linear Biases (ALiBi) instead of learned position embeddings, and incorporates a Gated Linear Unit (GeGLU) MLP and FlashAttention for improved efficiency.
### Model Specification
<table>
<thead>
<tr>
<th>Num Layers</th>
<th>Hidden Size</th>
<th>Num Heads</th>
<th>Intermediate Size</th>
<th>Num Parameters (M)</th>
<th>FLOPs (G)</th>
<th>MACs (G)</th>
<th>Max Num Tokens</th>
</tr>
</thead>
<tbody>
<tr>
<td>12</td>
<td>768</td>
<td>12</td>
<td>3072</td>
<td>117.07</td>
<td>125.83</td>
<td>62.92</td>
<td>512</td>
</tr>
</tbody>
</table>
### Links
- **Code**: [multimolecule.dnaberts](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/dnaberts)
- **Data**: [GenBank](https://www.ncbi.nlm.nih.gov/genbank)
- **Paper**: [DNABERT-S: pioneering species differentiation with species-aware DNA embeddings](https://doi.org/10.1093/bioinformatics/btaf188)
- **Developed by**: Zhihan Zhou, Weimin Wu, Harrison Ho, Jiayi Wang, Lizhen Shi, Ramana V Davuluri, Zhong Wang, Han Liu
- **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - [MosaicBERT](https://huggingface.co/mosaicml/mosaic-bert-base)
- **Original Repository**: [MAGICS-LAB/DNABERT_S](https://github.com/MAGICS-LAB/DNABERT_S)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
#### Feature Extraction
You can use this model directly with a pipeline for feature extraction:
```python
import multimolecule # you must import multimolecule to register models
from transformers import pipeline
predictor = pipeline("feature-extraction", model="multimolecule/dnaberts")
output = predictor("ATCGATCGATCG")
```
### Downstream Use
#### Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
```python
from multimolecule import DnaBertSModel
from transformers import AutoTokenizer
tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnaberts")
model = DnaBertSModel.from_pretrained("multimolecule/dnaberts")
text = "ATCGATCGATCGATCG"
input = tokenizer(text, return_tensors="pt")
output = model(**input)
```
#### Sequence Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
```python
import torch
from multimolecule import DnaBertSForSequencePrediction
from transformers import AutoTokenizer
tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnaberts")
model = DnaBertSForSequencePrediction.from_pretrained("multimolecule/dnaberts")
text = "ATCGATCGATCGATCG"
input = tokenizer(text, return_tensors="pt")
label = torch.tensor([1])
output = model(**input, labels=label)
```
#### Token Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for token classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
```python
import torch
from multimolecule import DnaBertSForTokenPrediction
from transformers import AutoTokenizer
tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnaberts")
model = DnaBertSForTokenPrediction.from_pretrained("multimolecule/dnaberts")
text = "ATCGATCGATCGATCG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
```
#### Contact Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
```python
import torch
from multimolecule import DnaBertSForContactPrediction
from transformers import AutoTokenizer
tokenizer = AutoTokenizer.from_pretrained("multimolecule/dnaberts")
model = DnaBertSForContactPrediction.from_pretrained("multimolecule/dnaberts")
text = "ATCGATCGATCGATCG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
```
## Training Details
DNABERT-S uses a two-phase Curriculum Contrastive Learning (C²LR) strategy. In phase I, the model is trained with Weighted SimCLR for one epoch. In phase II, the model is further trained with Manifold Instance Mixup (MI-Mix) for two epochs. The training starts from the pre-trained DNABERT-2 checkpoint.
### Training Data
The DNABERT-S model was trained on pairs of non-overlapping DNA sequences from the same species, sourced from [GenBank](https://www.ncbi.nlm.nih.gov/genbank). The dataset consists of 47,923 pairs from 17,636 viral genomes, 1 million pairs from 5,011 fungi genomes, and 1 million pairs from 6,402 bacteria genomes. From the total of 2,047,923 pairs, 2 million were randomly selected for training and the rest were used as validation data. All DNA sequences are 10,000 bp in length.
### Training Procedure
#### Pre-training
The model was trained on 8 NVIDIA A100 80GB GPUs.
- Temperature (τ): 0.05
- Hyperparameter (α): 1.0
- Epochs: 1 (phase I, Weighted SimCLR) + 2 (phase II, MI-Mix)
- Optimizer: Adam
- Learning rate: 3e-6
- Batch size: 48
- Checkpointing: Every 10,000 steps, best selected on validation loss
- Training time: ~48 hours
## Citation
```bibtex
@article{zhou2025dnaberts,
title={{DNABERT-S}: pioneering species differentiation with species-aware {DNA} embeddings},
author={Zhou, Zhihan and Wu, Weimin and Ho, Harrison and Wang, Jiayi and Shi, Lizhen and Davuluri, Ramana V and Wang, Zhong and Liu, Han},
journal={Bioinformatics},
volume={41},
pages={i255--i264},
year={2025},
doi={10.1093/bioinformatics/btaf188}
}
```
> [!NOTE]
> The artifacts distributed in this repository are part of the MultiMolecule project.
> If MultiMolecule supports your research, please cite the MultiMolecule project as follows:
```bibtex
@software{chen_2024_12638419,
author = {Chen, Zhiyuan and Zhu, Sophia Y.},
title = {MultiMolecule},
doi = {10.5281/zenodo.12638419},
publisher = {Zenodo},
url = {https://doi.org/10.5281/zenodo.12638419},
year = 2024,
month = may,
day = 4
}
```
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the [DNABERT-S paper](https://doi.org/10.1093/bioinformatics/btaf188) for questions or comments on the paper/model.
## License
This model implementation is licensed under the [GNU Affero General Public License](license.md).
For additional terms and clarifications, please refer to our [License FAQ](license-faq.md).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
``` |